Construct:Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug inhibits proliferation of human prostate cancer cells via downregulation of cyclin D1 expression.
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151- bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A [32], respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence: 50-CAGCTGTAAATACTGTGACAA-30) and pLKO.1-Slug shRNA2 (target sequence: 50-GCCAAATCATTTCAACTGAAA-30) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence: 50- CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) [33] or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) [34] were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. Generation of chicken anti-Slug antibody The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Subcloning:Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug inhibits proliferation of human prostate cancer cells via downregulation of cyclin D1 expression.
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151- bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A [32], respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence: 50-CAGCTGTAAATACTGTGACAA-30) and pLKO.1-Slug shRNA2 (target sequence: 50-GCCAAATCATTTCAACTGAAA-30) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence: 50- CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) [33] or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) [34] were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. Generation of chicken anti-Slug antibody The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Plasmid Preparation:Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug inhibits proliferation of human prostate cancer cells via downregulation of cyclin D1 expression.
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151- bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A [32], respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence: 50-CAGCTGTAAATACTGTGACAA-30) and pLKO.1-Slug shRNA2 (target sequence: 50-GCCAAATCATTTCAACTGAAA-30) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence: 50- CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) [33] or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) [34] were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. Generation of chicken anti-Slug antibody The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Sequencing:Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug inhibits proliferation of human prostate cancer cells via downregulation of cyclin D1 expression.
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151- bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A [32], respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence: 50-CAGCTGTAAATACTGTGACAA-30) and pLKO.1-Slug shRNA2 (target sequence: 50-GCCAAATCATTTCAACTGAAA-30) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence: 50- CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) [33] or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) [34] were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. Generation of chicken anti-Slug antibody The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
shRNA:Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: Slug inhibits proliferation of human prostate cancer cells via downregulation of cyclin D1 expression.
Article Snippet: .. The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151- bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A [32], respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence: 50-CAGCTGTAAATACTGTGACAA-30) and pLKO.1-Slug shRNA2 (target sequence: 50-GCCAAATCATTTCAACTGAAA-30) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence: 50- CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) [33] or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) [34] were purchased from Addgene (Cambridge, MA). .. The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression
Article Snippet: .. Plasmids The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA). .. Generation of chicken anti-Slug antibody The chicken anti-Slug antibody was custom made using a short peptide (LQ[S/P]KLSDPHAIEAEK) and purified by Aves Labs (Tigard, OR).
Cloning:Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Retroviral:Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
Control:Article Title: SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.
Article Snippet: .. pMig-Slug was constructed by cloning human SLUG gene into pMIGR1 retroviral vector. pLKO.1-Slug shRNA1 (target sequence: 5’-CAGCTGTAAATACTGTGACAA-3’), pLKO.1-Slug shRNA2 (target sequence: 5’- CCAAATCATTTCAACTGAAA-3’), pLKO.1-CXCL12 shRNA1 (target sequence: 5’-TGTGCATTGACCCGAAGCTAA), and pLKO.1-CXCL12 shRNA2 (target sequence: 5’-GCCAACGTCAAGCATCTCAAA-3’) were obtained from Open Biosystem (Huntville, AL). pLKO.1 control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) were purchased from Addgene (Cambridge, MA). ..
|
Addgene inc is a verified supplier 